香京julia种子在线播放

Fly stocks and all fly crosses were maintained at 25°C on standard fly food. The following fly stocks were used: hh-Gal4, UAS-mCD8-gfp/TM6B (Ren et al., 2018); Vha100-2 RNAi (TH04790.N; TsingHua Fly Center); FRT42D, Vha44^KG00915/Cyo (#111534; Kyoto Stock Center); FRT42D, Vha44^K05440/Cyo (#111081; Kyoto Stock Center); FRT82B, Vha100-1¹/TM3, Sb (#39669; Bloomington Drosophila Stock Center); w;Sco/Cyo (#2555; Bloomington Drosophila Stock Center); and w;TM3/TM6B (#2537; Bloomington Drosophila Stock Center). The Ubx-FLP; FRT82B, Ubi-RFP/TM6B, Ubx-FLP; FRT42D, Ubi-RFP/Cyo, and Ubx-FLP; FRT42D, Ubi-GFP/Cyo stocks were used to generate mosaic mutant clones in the wing disks (Ren et al., 2018). The sens−GFP reporter was described before (Sarov et al., 2016) and obtained from Bloomington Drosophila Stock Center (#38666). The fz3-LacZ reporter was described before (Sato et al., 1999).

The sgRNA targets were designed against the genomic sequences of Vha100-2, Vha100-3, Vha100-4, and Vha100-5 with CRISPR Optimal Target Finder¹ (Gratz et al., 2014). Templates for sgRNA transcription were generated by annealing of two DNA oligonucleotides and subsequent PCR amplification (Bassett et al., 2013). In vitro transcription was performed with the T7 RiboMAX^TM Kit (Promega, P1320) and the sgRNAs were purified by phenol-choloroform extraction and isopropanol precipitation. Cas9 mRNA was transcribed with the mMESSAGE mMACHINE^® T7 Transcription Kit (Ambion), using a linearized plasmid containing the Cas9 cDNA (Addgene plasmid 42251) as template. The Cas9 mRNA were polyadenylated with the Escherichia coli Poly(A) polymerase Kit (NEB), and purified with the RNeasy Mini Kit (QIAGEN). 15 μg of Cas9 mRNA and 7.5 μg sgRNA were mixed with DEPC water in a 30 μl volume for embryo injection. Fly embryos of the w¹¹¹⁸ strain (#5905; Bloomington Drosophila Stock Center) were injected using standard protocols by Fungene Biotech (Beijing, China).

Males developed from the injected embryos (G0) were outcrossed to virgin females of TM3/TM6B (for Vha100-2 and Vha100-4) or Sco/Cyo (for Vha100-3 and Vha100-5). Single G1 males were each crossed to 4–5 females of the corresponding balancer stocks and the progenies (G2) bearing the same balancer chromosome were maintained as an independent stock. About 50 G2 stocks were established from each injection, and mutations were screened by PCR test of genomic DNAs. Primer pairs were designed to generate PCR products covering the target sites, which were compared with the control sequences amplified from w¹¹¹⁸ genomic DNA. The primers used are: V100-2F: AACGTTGTCGTTGGCTGAAGCA; V100-2R: ATGT CATCCTGGATGTCGGGCA; V100-3F: CTGCGCATCGTGG ACAGTCTG; V100-3R: GAATGATCAGGTTGAAGGAGC; V100-4F: GCTGTGCTCCGAAAGTGAG; V100-4R: ACCT TGTGACCCTCCTTGTT; V100-5F: CAGTTATAACACTCG ATTTGA; and V100-5R: TTGAGTTCTTGCATGTGCCGGA. Mutant alleles were identified and named as Vha100-2^D2, Vha100-3^D3, Vha100-4^D4, and Vha100-5^D5. FRT82B (#2035; Bloomington Drosophila Stock Center) was recombined into the Vha100-2^D2 and Vha100-4^D4 mutant genomes by standard genetic crosses for further mosaic analysis.

The coding regions of Vha100-2 (1208 bp–1430 bp of GeneBank #AAF55551) and Vha100-4 (982 bp–1240 bp of GeneBank #AAF55550) were used to generate antisense RNA probes for in situ hybridization. An autofluorescent alkaline phosphatase substrate (Vector) was used to visualize mRNA in the rhodamine channel, and mutant clones were marked by immunofluorescence staining of GFP protein as described before (Su et al., 2011).

Wing disks dissected from third-instar larvae were fixed in 4% paraformaldehyde for 15 min, blocked in PBS containing 0.1% Triton X–100 and 0.2% BSA for 1 h, and incubated overnight at 4°C with the following primary antibodies: mouse anti-Cut (1:100; 2B10; and DSHB), mouse anti-Wingless (1:200; 4D4; and DSHB), mouse anti-Notch intracellular domain NICD (1:200; C17.9C6; and DSHB), mouse anti- Notch extracellular domain NECD (1:200; C458.2H; and DSHB), mouse anti-Dl (1:200; C594.9B; and DSHB), rabbit anti-GFP (1:2000; A11122; and Thermo Fisher), and rabbit anti-Caspase3 (1:200; Cell signaling). Alexa fluor-conjugated secondary antibodies (1:400; Invitrogen) were used. Alexa fluor-568 conjugated phalloidin was used to label cell morphology (1:200; Thermo Fisher). The fluorescence images were acquired with Leica SP8 confocal microscope and processed in Photoshop and ImageJ.

Adult flies with correct genotypes were collected and fixed overnight in isopropanol. Dissected adult wings were mounted in Euparal mounting media (BioQuip). For Eosin Y and FB28 staining experiments, 2 days old files were fixed in formaldehyde phosphate buffer, washed several times with PBS, and stained with FB28 solution (1 mg/ml; Sigma-Aldrich) at room temperature for 1 h or 0.5% Eosin Y at 55°C for 35 min. Adult wings were then dissected and mounted in 80% glycerol. The images were captured with a Leica DMIL inverted microscope equipped with a QICAM Fast 1394 digital camera.

The a subunit of the V-ATPase is encoded by five genes in Drosophila, which are spread at different locations throughout the genome (Supplementary Figures S1A–D). The -1, -2, -3, -4, and -5 isoform comprises 855, 834, 904, 844, and 814 amino acid residues, respectively. A hidden Markov model (Krogh et al., 2001; http://www.cbs.dtu.dk/services/TMHMM-2.0/) predicated that these isoforms have closely similar structures with seven putative transmembrane regions, which are conserved among the five isoforms (Figure 1). High conservation is also evident for the hydrophilic amino and hydrophobic carboxy terminals of fly Vha100 isoforms (Figure 1). Detailed analysis of sequence homology reveals that Vha100-3 is the most diverse member of the family, while the other isoforms share a similarity about 70% between each other (Table 1). A number of residues of the a subunit have been experimentally demonstrated to be important for the activity or assembly of V-ATPase complex in yeast (Leng et al., 1996, 1998), which were later found to be conserved in mouse orthologs (Nishi and Forgac, 2000; Toyomura et al., 2000). All of these residues are conserved in the fly isoforms, with the exception of L800 (the Vha100-1 numbering), which is conserved in -3 and -5 but is a phenylalanine in -2 and -4 (Figure 1). It is likely that the less conserved regions may render different functions of Vha100 isoforms. Construction of a phylogenetic tree (Minh et al., 2013; Trifinopoulos et al., 2016) using the mouse, fly and yeast sequences reveals that the development of multiple isoforms of the a subunit appears to have occurred independently in these species (Supplementary Figure S1E).

Previous studies have isolated several Vha100-1 mutant alleles and revealed a neuronal specific role of Vha100-1 during fly development (Hiesinger et al., 2005). For the other four isoforms, mutagenesis analyses have not been reported yet. To better understand how Vha100 isoforms function in different developmental contexts, we generated Vha100-2, Vha100-3, Vha100-4, and Vha100-5 mutants by CRISPR-Cas9 mediated genome editing (Table 2). Mutations with small deletions were identified by genomic DNA PCR (Supplementary Figure S2) and used for further analysis (Figure 2A). Homozygous Vha100-3^D3 and Vha100-5^D5 mutant flies are viable and fertile with normal appearance of body structure and tissue morphology. Previous studies have shown that the expression of Vha100-3 is restricted to the testes in adult males, while the mRNA of Vha100-5 is undetectable by in situ hybridization in fly larvae (Wang et al., 2004; Allan et al., 2005). We reason that these two isoforms might perform specific physiological roles, but are dispensable for fly development. Therefore, we moved on to examine the roles of Vha100-1, Vha100-2, and Vha100-4 in fly wing development.

As Vha100-1¹ (Hiesinger et al., 2005), Vha100-2^D2, and Vha100-4^D4 are homozygous lethal mutants, somatic mosaic clones were generated using the FLP-FRT system to examine their roles in wing development. The FLP recombinase catalyzes exchange of the homologous chromosome arms and induces the generation of homozygous mutant cell clones with randomized size and location (Xu and Rubin, 1993). Importantly, the wild type cells surrounding the mutant clones serve as rigorous internal control for developmental studies (Theodosiou and Xu, 1998). Taking advantage of the FLP-FRT system, we evaluated whether Vha100-2^D2 and Vha100-4^D4 (Figure 2A) behave as loss-of-function alleles by examining their mRNA levels in mutant mosaic clones. Both Vha100-2 (Figure 2B) and Vha100-4 (Figure 2C) were ubiquitously expressed in wing disk cells. Compared with the neighboring wild type cells, the expression level of Vha100-2 were significantly down-regulated in Vha100-2^D2 homozygous cells (Figure 2D). The expression of Vha100-4 were also obviously decreased in Vha100-4^D4 clones (Figure 2E).

We first examined the overall requirement of V-ATPase activity during wing development, and the contributions of distinct Vha100 isoforms were further dissected. Two mutants of the regulatory C subunit Vha44 were tested (Supplementary Figure S3A) and both of them resulted in various developmental defects including loss of wing marginal bristles and nicking of wing margin (Supplementary Figures S3B–D). We then investigated whether Vha44 regulates Notch (N) and Wingless (Wg) signaling activity, two major signaling pathways that were affected by mutations of other V-ATPase subunits (Vaccari et al., 2010; Kobia et al., 2013; Gleixner et al., 2014; Portela et al., 2018; Ren et al., 2018). In the wild type imaginal wing disk, the N target gene cut is produced in a narrow stripe of cells along the dorsal/ventral (D/V) boundary (Supplementary Figure S3E). In Vha44^K05440 mutant clones, the expression of Cut is abolished when the clones are located at the D/V boundary (Supplementary Figure S3F). Clones of Vha44 mutant cells also displayed various degrees of accumulation of the ligand molecule Delta (Dl) and N protein itself, which were detected as intracellular puncta (Supplementary Figures S3G–J). During fly wing development, the Wg protein is generated at the D/V boundary (Supplementary Figure S3K) and transported throughout the wing disk to activate down-stream targets (Swarup and Verheyen, 2012). In Vha44 mutant cells, the expression level of Wg was not significantly affected, while the distribution of Wg protein in signal receiving cells was altered (Supplementary Figure S3L). As a consequence, the activity of Wg signaling was dampened in Vha44 mutant cells (Supplementary Figures S3M,N), which was monitored by a fz3-LacZ reporter (Sato et al., 1999). In addition, we found that Vha44^K05440 mutant cells displayed aberrant cellular cortex morphology (Supplementary Figures S3O,P) and likely underwent apoptosis (Supplementary Figures S3Q,R).

In contrast to the Vha44 mutants, fly wings harboring homozygous Vha100-2^D2 mutant clones displayed wrinkles in the wing surface, without disruption of the vein patterns and wing margin integrity (Figures 3A,B). In agreement with the lack of patterning defects in the adult wing, the expression of Cut remained unaltered in Vha100-2^D2 mutant clones (Supplementary Figure S4A). The expression level and distribution of Wg, N, and Dl proteins were also normal in Vha100-2^D2 mutant cells (Supplementary Figures S4B–D), suggesting that Vha100-2 is not required for these two pathways. Furthermore, phalloidin staining showed that Vha100-2^D2 mutant had little influence for cell morphology (Supplementary Figure S4E). Wrinkling of the wing surface is often associated with defective cuticle deposition (Moussian, 2010). To further characterize the role of Vha100-2 on wing cuticle formation, we analyzed the cuticle impermeability by FB28 and Eosin Y staining (Wang et al., 2016, 2017). Wild-type wings with an intact cuticle layer is almost resistant to Eosin Y penetration (Figure 3A). By contrast, wings harboring homozygous Vha100-2^D2 mutant clones showed patches of Eosin Y staining (Figure 3B). Similarly, a polysaccharide-specific dye FB28 was able to penetrate through the cuticle of wings bearing Vha100-2^D2 mutant clones (Figures 3C,D). We further confirmed the role of Vha100-2 in cuticle integrity by knock-down of Vha100-2 expression in the posterior compartment of the wing. Regional specific inhibition of Vha100-2 led to wrinkles in the RNAi expressing area as well as diffusion of the FB28 dye (Figure 3E). Consistent with the adult wing phenotype, RNAi knock-down led to attenuation of Vha100-2 mRNA level when examined in the wing disk (Figure 3F). Taken together, our results suggest that Vha100-2 might be involved in cuticle formation of the wing.

When Vha100-4^D4 mutant clones were induced in the wing, marginal notches and bristle loss were observed (Figures 4A,B). These marginal defects are typically resulted from disruption of N or Wg signaling activity (Logan and Nusse, 2004). Interestingly, we found that neither the target Cut nor the signaling molecules (N and Dl) were changed in Vha100-4^D4 mutant cells (Supplementary Figure S5). On the other hand, aggregation of Wg proteins were observed in some mutant cells (Figures 4C,D), and the expression of the Wg activity reporter fz3-LacZ (Figures 4E,F), and sens-GFP (Figures 4G,H) were dampened in a subset of Vha100-4^D4 mutant clones. Collectively, these findings provide evidence that Vha100-4 is likely involved in Wg signaling activation during fly wing development.

Although previous studies suggest that Vha100-1 functions in the neuronal system to regulate fly development (Hiesinger et al., 2005; Wang et al., 2014), we noticed that ectopic veins were formed in wings bearing Vha100-1¹ mutant clones (Figures 5A,B). However, N and Wg signaling were not affected in Vha100-1¹ mutant cells (Supplementary Figures S6A,B). In addition, we noticed that Vha100-1¹ mutant cells did not undergo apoptosis (Supplementary Figure S6C) and displayed normal cell morphology (Supplementary Figure S6D). The overall patterning and wing margin integrity was not affected by Vha100-1¹ mutant clones, suggesting that Vha100-1 might function in specific processes during vein cell differentiation.

Mutations of Vha100-1, Vha100-2, and Vha100-4 were unable to fully recapture the wing defects caused by Vha44 mutant, despite that they are all essential genes required for normal development. These results indicate that these isoforms may function redundantly and the loss of single isoform can be compensated by the remaining family members in certain developmental contexts. To test this hypothesis, we crossed Vha100-1¹, Vha100-2^D2, and Vha100-4^D4 flies with each other and examined the wing phenotypes in the trans-heterozygous progenies. For each mutant allele, the heterozygotes were indistinguishable with wild type controls (Figures 5C–E). The wings of Vha100-1¹/Vha100-4^D4 flies were severely malformed (Figure 5F), indicating a strong genetic interaction and functional redundancy between Vha100-1 and Vha100-4. Combination of Vha100-2^D2 with either Vha100-1¹ (Figure 5G) or Vha100-4^D4 (Figure 5H) shows no effect on fly development and wing morphology, suggesting that Vha100-2 likely functions independently of the other two isoforms.